Review



dna plasmid pcdna3 flag pten  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc dna plasmid pcdna3 flag pten
    Dna Plasmid Pcdna3 Flag Pten, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pmc11598603-65-46-50
    Average 93 stars, based on 12 article reviews
    dna plasmid pcdna3 flag pten - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Exosomal miR-9 released from HIV Tat stimulated astrocytes mediates microglial migration
    Article Snippet: Plasmid and oligo transfection A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. Plasmid and oligo transfection A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. The custom-designed PTEN-Target Protector negative control (TP-ctrl: scramble sequence: CTCCACAGGAAGGTATTTCTAGTCT) and PTEN-Target Protector (TP-PTEN: TAGTTTCAACATATAATTTGGTTTC) were purchased from Integrated DNA Technologies.

    Article Title: Exosomal miR-9 released from HIV Tat stimulated astrocytes mediates microglial migration
    Article Snippet: A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. ..

    Article Title: Investigating the role of Hedgehog/GLI1 signaling in glioblastoma cell response to temozolomide
    Article Snippet: RNA interference was performed using Dharmafect 1 (Dharmacon, Lafayette, CO) according to the manufacturer’s protocol to deliver 100 nM siRNA (Integrated DNA Technologies, Coralville, IA) to cells at approximately 50–60% confluence. .. Four hours post-transfection, media containing transfection reagents was removed and replaced with fresh media, and cells were incubated at 37° C, 5% CO 2 for 72 hours prior to continued experimentation. siRNA sequences used in this study are as follows (written 5′ to 3′): siGLI1 sense: CCA GGA AUU UGA CUC CCA ATT, siGLI1 antisense: UUG GGA GUC AAA UUC CUG GCT, siScramble (siScr) sense: GUG CAC CAA CGA CUU AUC ATT, siScr antisense: UGA UAA GUC GUU GGU GCA CT. Plasmid DNA transfections were performed using Mirus TransIT X2 (Mirus Bio LLC, Madison, WI) to deliver 25 ng/mL pcDNA3-FLAG PTEN (Addgene #78777) or pcDNA3-FLAG HA (Addgene #10792) to cells at approximately 80% confluence. ..

    Article Title: ZFYVE21 is a complement-induced Rab5 effector that activates non-canonical NF-κB via phosphoinosotide remodeling of endosomes
    Article Snippet: .. The PH-RFP and 2XFYVE-GFP constructs contain a PH domain derived from Akt1 showing preferential binding to PI(3,4,5)P3 > PI(3,4,)P2 and a FYVE domain from HRS binding PI(3)P, respectively. pcDNA3-FLAG PTEN was a gift from Jaewhan Song (Addgene plasmid #78777). mCherry-Rab5WT was a gift from Gia Voeltz (Addgene plasmid #49201). mCherry-Rab5DN (S34N) was a gift from Sergio Grinstein (Addgene plasmid #35139). .. Rab5-GFP lentiviral particles were purchased commercially (AMS Biosciences). mCherry-FKBP-MTM1 was a gift from Tamas Balla (Addgene plasmid #51614). pCMV5B-Flag-SMURF2 C716A was a gift from Jeff Wrana (Addgene plasmid #11747). pRK-Myc-SMURF2 was a gift from Ying Zhang (Addgene plasmid #13678).

    Transfection:

    Article Title: Exosomal miR-9 released from HIV Tat stimulated astrocytes mediates microglial migration
    Article Snippet: Plasmid and oligo transfection A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. Plasmid and oligo transfection A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. The custom-designed PTEN-Target Protector negative control (TP-ctrl: scramble sequence: CTCCACAGGAAGGTATTTCTAGTCT) and PTEN-Target Protector (TP-PTEN: TAGTTTCAACATATAATTTGGTTTC) were purchased from Integrated DNA Technologies.

    Article Title: Exosomal miR-9 released from HIV Tat stimulated astrocytes mediates microglial migration
    Article Snippet: A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. ..

    Article Title: Investigating the role of Hedgehog/GLI1 signaling in glioblastoma cell response to temozolomide
    Article Snippet: RNA interference was performed using Dharmafect 1 (Dharmacon, Lafayette, CO) according to the manufacturer’s protocol to deliver 100 nM siRNA (Integrated DNA Technologies, Coralville, IA) to cells at approximately 50–60% confluence. .. Four hours post-transfection, media containing transfection reagents was removed and replaced with fresh media, and cells were incubated at 37° C, 5% CO 2 for 72 hours prior to continued experimentation. siRNA sequences used in this study are as follows (written 5′ to 3′): siGLI1 sense: CCA GGA AUU UGA CUC CCA ATT, siGLI1 antisense: UUG GGA GUC AAA UUC CUG GCT, siScramble (siScr) sense: GUG CAC CAA CGA CUU AUC ATT, siScr antisense: UGA UAA GUC GUU GGU GCA CT. Plasmid DNA transfections were performed using Mirus TransIT X2 (Mirus Bio LLC, Madison, WI) to deliver 25 ng/mL pcDNA3-FLAG PTEN (Addgene #78777) or pcDNA3-FLAG HA (Addgene #10792) to cells at approximately 80% confluence. ..

    Article Title: EIF4E Phosphorylation as a Mechanism of Resistance To mTOR and Androgen Receptor Inhibition in Advanced Prostate Cancer
    Article Snippet: .. The following plasmids were used in the transfections: pCDNA3 (Invitrogen, Carlsbad, CA), pRL—HCV—FL (kindly provided by Dr. Xinbin Chen, UC Davis School of Veterinary Medicine), pcDNA3—FLAG PTEN (Addgene), pHA—eIF4E (Addgene), elF4E siRNA (sense: GGAUGGUAUUGAGCCUAUGTT, antisense: CAUAGGCUCAAUACCAUCCTT), and control siRNA (Cell Signaling Technology, Beverly, MA). .. Mouse studies Mice (4—5—week—old, nu/nu athymic male) were obtained from Harlan Sprague—Dawley, Inc. and implanted subcutaneously (s.c.) with sustained release testosterone pellets (12.5mg, 90— day release; Innovative Research of America).

    Article Title: Metabolic Impact of MKP-2 Upregulation in Obesity Promotes Insulin Resistance and Fatty Liver Disease
    Article Snippet: .. Mouse embryonic fibroblasts (MEFs) derived from Mkp-2 +/+ and Mkp-2 −/− mice were cultured as described [ ] and transfected with pcDNA3-FLAG PTEN (Cat.#78777; Addgene). ..

    Article Title: The Androgen Receptor is a negative regulator of eIF4E Phosphorylation at S209: Implications for the use of mTOR inhibitors in advanced prostate cancer
    Article Snippet: Cells were transiently transfected using Lipofectamine2000 (Invitrogen, Grand Island, NY) according to manufacturer’s specifications. .. The following plasmids were used in the transfections: pCDNA3 (Invitrogen, Carlsbad, CA), pRL-HCV-FL (kindly provided by Dr. Xinbin Chen, UC Davis School of Veterinary Medicine), pcDNA3-FLAG PTEN (Addgene), pHA-eIF4E (Addgene), eIF4E siRNA (sense: GGAUGGUAUUGAGCCUAUGTT, antisense: CAUAGGCUCAAUACCAUCCTT), and control siRNA (Cell Signaling Technology, Beverly, MA). .. Mice (4–5-week-old, nu/nu athymic male) were obtained from Harlan Sprague-Dawley, Inc. and implanted subcutaneously (s.c.) with sustained release testosterone pellets (12.5mg, 90-day release; Innovative Research of America).

    Control:

    Article Title: Exosomal miR-9 released from HIV Tat stimulated astrocytes mediates microglial migration
    Article Snippet: Plasmid and oligo transfection A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. Plasmid and oligo transfection A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. The custom-designed PTEN-Target Protector negative control (TP-ctrl: scramble sequence: CTCCACAGGAAGGTATTTCTAGTCT) and PTEN-Target Protector (TP-PTEN: TAGTTTCAACATATAATTTGGTTTC) were purchased from Integrated DNA Technologies.

    Article Title: Exosomal miR-9 released from HIV Tat stimulated astrocytes mediates microglial migration
    Article Snippet: A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. .. A172 cells were transfected with 0.5μg pEF6.mCherry-TSG101 plasmid (Addgene, Plasmid #38318, Cambridge, MA) and BV-2 cells were transfected with 0.5μg pcDNA3-Flag PTEN (Addgene, Plasmid #78777, Cambridge, MA) / control plasmid or target protector by using the LipofectaminTM 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. ..

    Article Title: EIF4E Phosphorylation as a Mechanism of Resistance To mTOR and Androgen Receptor Inhibition in Advanced Prostate Cancer
    Article Snippet: .. The following plasmids were used in the transfections: pCDNA3 (Invitrogen, Carlsbad, CA), pRL—HCV—FL (kindly provided by Dr. Xinbin Chen, UC Davis School of Veterinary Medicine), pcDNA3—FLAG PTEN (Addgene), pHA—eIF4E (Addgene), elF4E siRNA (sense: GGAUGGUAUUGAGCCUAUGTT, antisense: CAUAGGCUCAAUACCAUCCTT), and control siRNA (Cell Signaling Technology, Beverly, MA). .. Mouse studies Mice (4—5—week—old, nu/nu athymic male) were obtained from Harlan Sprague—Dawley, Inc. and implanted subcutaneously (s.c.) with sustained release testosterone pellets (12.5mg, 90— day release; Innovative Research of America).

    Article Title: The Androgen Receptor is a negative regulator of eIF4E Phosphorylation at S209: Implications for the use of mTOR inhibitors in advanced prostate cancer
    Article Snippet: Cells were transiently transfected using Lipofectamine2000 (Invitrogen, Grand Island, NY) according to manufacturer’s specifications. .. The following plasmids were used in the transfections: pCDNA3 (Invitrogen, Carlsbad, CA), pRL-HCV-FL (kindly provided by Dr. Xinbin Chen, UC Davis School of Veterinary Medicine), pcDNA3-FLAG PTEN (Addgene), pHA-eIF4E (Addgene), eIF4E siRNA (sense: GGAUGGUAUUGAGCCUAUGTT, antisense: CAUAGGCUCAAUACCAUCCTT), and control siRNA (Cell Signaling Technology, Beverly, MA). .. Mice (4–5-week-old, nu/nu athymic male) were obtained from Harlan Sprague-Dawley, Inc. and implanted subcutaneously (s.c.) with sustained release testosterone pellets (12.5mg, 90-day release; Innovative Research of America).

    Incubation:

    Article Title: Investigating the role of Hedgehog/GLI1 signaling in glioblastoma cell response to temozolomide
    Article Snippet: RNA interference was performed using Dharmafect 1 (Dharmacon, Lafayette, CO) according to the manufacturer’s protocol to deliver 100 nM siRNA (Integrated DNA Technologies, Coralville, IA) to cells at approximately 50–60% confluence. .. Four hours post-transfection, media containing transfection reagents was removed and replaced with fresh media, and cells were incubated at 37° C, 5% CO 2 for 72 hours prior to continued experimentation. siRNA sequences used in this study are as follows (written 5′ to 3′): siGLI1 sense: CCA GGA AUU UGA CUC CCA ATT, siGLI1 antisense: UUG GGA GUC AAA UUC CUG GCT, siScramble (siScr) sense: GUG CAC CAA CGA CUU AUC ATT, siScr antisense: UGA UAA GUC GUU GGU GCA CT. Plasmid DNA transfections were performed using Mirus TransIT X2 (Mirus Bio LLC, Madison, WI) to deliver 25 ng/mL pcDNA3-FLAG PTEN (Addgene #78777) or pcDNA3-FLAG HA (Addgene #10792) to cells at approximately 80% confluence. ..

    Derivative Assay:

    Article Title: Metabolic Impact of MKP-2 Upregulation in Obesity Promotes Insulin Resistance and Fatty Liver Disease
    Article Snippet: .. Mouse embryonic fibroblasts (MEFs) derived from Mkp-2 +/+ and Mkp-2 −/− mice were cultured as described [ ] and transfected with pcDNA3-FLAG PTEN (Cat.#78777; Addgene). ..

    Article Title: ZFYVE21 is a complement-induced Rab5 effector that activates non-canonical NF-κB via phosphoinosotide remodeling of endosomes
    Article Snippet: .. The PH-RFP and 2XFYVE-GFP constructs contain a PH domain derived from Akt1 showing preferential binding to PI(3,4,5)P3 > PI(3,4,)P2 and a FYVE domain from HRS binding PI(3)P, respectively. pcDNA3-FLAG PTEN was a gift from Jaewhan Song (Addgene plasmid #78777). mCherry-Rab5WT was a gift from Gia Voeltz (Addgene plasmid #49201). mCherry-Rab5DN (S34N) was a gift from Sergio Grinstein (Addgene plasmid #35139). .. Rab5-GFP lentiviral particles were purchased commercially (AMS Biosciences). mCherry-FKBP-MTM1 was a gift from Tamas Balla (Addgene plasmid #51614). pCMV5B-Flag-SMURF2 C716A was a gift from Jeff Wrana (Addgene plasmid #11747). pRK-Myc-SMURF2 was a gift from Ying Zhang (Addgene plasmid #13678).

    Cell Culture:

    Article Title: Metabolic Impact of MKP-2 Upregulation in Obesity Promotes Insulin Resistance and Fatty Liver Disease
    Article Snippet: .. Mouse embryonic fibroblasts (MEFs) derived from Mkp-2 +/+ and Mkp-2 −/− mice were cultured as described [ ] and transfected with pcDNA3-FLAG PTEN (Cat.#78777; Addgene). ..

    Construct:

    Article Title: ZFYVE21 is a complement-induced Rab5 effector that activates non-canonical NF-κB via phosphoinosotide remodeling of endosomes
    Article Snippet: .. The PH-RFP and 2XFYVE-GFP constructs contain a PH domain derived from Akt1 showing preferential binding to PI(3,4,5)P3 > PI(3,4,)P2 and a FYVE domain from HRS binding PI(3)P, respectively. pcDNA3-FLAG PTEN was a gift from Jaewhan Song (Addgene plasmid #78777). mCherry-Rab5WT was a gift from Gia Voeltz (Addgene plasmid #49201). mCherry-Rab5DN (S34N) was a gift from Sergio Grinstein (Addgene plasmid #35139). .. Rab5-GFP lentiviral particles were purchased commercially (AMS Biosciences). mCherry-FKBP-MTM1 was a gift from Tamas Balla (Addgene plasmid #51614). pCMV5B-Flag-SMURF2 C716A was a gift from Jeff Wrana (Addgene plasmid #11747). pRK-Myc-SMURF2 was a gift from Ying Zhang (Addgene plasmid #13678).

    Binding Assay:

    Article Title: ZFYVE21 is a complement-induced Rab5 effector that activates non-canonical NF-κB via phosphoinosotide remodeling of endosomes
    Article Snippet: .. The PH-RFP and 2XFYVE-GFP constructs contain a PH domain derived from Akt1 showing preferential binding to PI(3,4,5)P3 > PI(3,4,)P2 and a FYVE domain from HRS binding PI(3)P, respectively. pcDNA3-FLAG PTEN was a gift from Jaewhan Song (Addgene plasmid #78777). mCherry-Rab5WT was a gift from Gia Voeltz (Addgene plasmid #49201). mCherry-Rab5DN (S34N) was a gift from Sergio Grinstein (Addgene plasmid #35139). .. Rab5-GFP lentiviral particles were purchased commercially (AMS Biosciences). mCherry-FKBP-MTM1 was a gift from Tamas Balla (Addgene plasmid #51614). pCMV5B-Flag-SMURF2 C716A was a gift from Jeff Wrana (Addgene plasmid #11747). pRK-Myc-SMURF2 was a gift from Ying Zhang (Addgene plasmid #13678).



    Similar Products

    93
    Addgene inc dna plasmid pcdna3 flag pten
    Dna Plasmid Pcdna3 Flag Pten, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pmc11598603-65-46-50
    Average 93 stars, based on 1 article reviews
    dna plasmid pcdna3 flag pten - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 flagpten
    Pcdna3 Flagpten, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pm38520717-316-26-35
    Average 93 stars, based on 1 article reviews
    pcdna3 flagpten - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 flag pten
    Pcdna3 Flag Pten, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pmc11165541-231-0-9
    Average 93 stars, based on 1 article reviews
    pcdna3 flag pten - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc mrna template construction
    Mrna Template Construction, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pm38520717-316-19-35
    Average 93 stars, based on 1 article reviews
    mrna template construction - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc mammalian expression plasmid pcdna3
    Mammalian Expression Plasmid Pcdna3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pm37804961-46-3-11
    Average 93 stars, based on 1 article reviews
    mammalian expression plasmid pcdna3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 flag pten plasmid
    Pcdna3 Flag Pten Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+flag+pten/pcDNA3-FLAG+PTEN+(Plasmid+%2378777)/pmc06877308-483-1-10
    Average 93 stars, based on 1 article reviews
    pcdna3 flag pten plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results